|
Addgene inc
bbsi digested pxr003 vector Bbsi Digested Pxr003 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pXR003%3A+CasRx+gRNA+cloning+backbone+(Plasmid+%23109053)/pm41928225-94-9-12 Average 95 stars, based on 1 article reviews
bbsi digested pxr003 vector - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Addgene inc
bbsi digested plasmid pspcas9bb 2a gfp px458 Bbsi Digested Plasmid Pspcas9bb 2a Gfp Px458, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm41910145-319-12-16 Average 96 stars, based on 1 article reviews
bbsi digested plasmid pspcas9bb 2a gfp px458 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
bbsi digested pklv2 u6grna5 bbsi pgkpuro2amcherry w Bbsi Digested Pklv2 U6grna5 Bbsi Pgkpuro2amcherry W, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W+(Plasmid+%2367977)/bio_rxiv__64898__2026__03__19__709783-184-22-30 Average 93 stars, based on 1 article reviews
bbsi digested pklv2 u6grna5 bbsi pgkpuro2amcherry w - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sequences aaactcccgtgcttgtgctgagtgc Sequences Aaactcccgtgcttgtgctgagtgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41683574-279-14-19 Average 96 stars, based on 1 article reviews
sequences aaactcccgtgcttgtgctgagtgc - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
bbsi digested pspcas9 bb 2a puro Bbsi Digested Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc12929130-56-16-20 Average 96 stars, based on 1 article reviews
bbsi digested pspcas9 bb 2a puro - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector 2026 Bbsi Digested Px330 U6 Chimeric Bb Cbh Hspcas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41572572-57-44-53 Average 96 stars, based on 1 article reviews
2026 bbsi digested px330 u6 chimeric bb cbh hspcas9 vector - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
bbsi digested px330 Bbsi Digested Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__64898__2026__01__15__699681-206-35-41 Average 96 stars, based on 1 article reviews
bbsi digested px330 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
bbsi digested px459 Bbsi Digested Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bbsi+plasmid+digest/pSpCas9(BB)-2A-Puro+(PX459)+(Plasmid+%2348139)/pmc12926204-37-0-3 Average 96 stars, based on 1 article reviews
bbsi digested px459 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |